Detection of Biofilm Genes (gtf) in Streptococcus mutans Isolated from Human Dental Caries من عينات تسوس االسنان

Transcription

1 Detection of Biofilm Genes (gtf) in Streptococcus mutans Isolated from Human Dental Caries Adhraa S. Flayyih 1 *, Hayfa H.Hassani, Mohammed H. Wali 1 Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq College of Applied Biotechnology, Al-Nahrin University, Baghdad, Iraq Abstract: Sixty samples from saliva and dental plaque were selected from patients with caries active at ages from 4-65years. isolates belong to Streptococcus mutans. All isolates pronounced adhesion and biofilm formation in various degrees. By using Polymerase Chain Reaction PCR Techniques, it was found that these isolates had gtfb encode GtfB with 80 bp, gtfc encode GtfC with 81 bp, and gtfd with 34 bp which explain their potential of biofilm formation. Keywords: PCR, gtf, Streptococcus mutans. التحري عن جينات )gtf( المكونة للغشاء الحيوي في بكتريا Streptococcus mutans المعزولة الخالصة من عينات تسوس االسنان 1 عذراء صالح فليح *, هيفاء هادي حساني, محمد حسين والي 1 قسم علوم الحیاة كلیة العلوم جامعة بغداد بغداد الع ارق كلیة التقنیات الحیویة التطبیقیة جامعة النهرین بغداد الع ارق في هذه الد ارسة جمعت ستون عینة من اللعاب و االسنان المتسوسة من مرضى یعانون من تسوس االسنان باعمار مختلفة ت اروحت بین 56-4 سنة واختبرت قابلیة عزالت.S mutans على االلتصاق الحیوي ووجد بانها تمتلك القدرة على تكوین االغشیة الحیاتیة بدرجات متفاوتة. لجینات gtf التي تساهم في تكوین االغشیة الحیویة باستخدام تقنیة ال تم تشخیص امتالك هذه العزالت PCR ) Polymerase Chain Reaction ووجد ان 08 والمشفر النزیم GtfC و 44 زوج قاعدة لجین gtfb والمشفر النزیم GtfB و 08 زوج قاعدة لجین gtfc زوج قاعدة لجین gtfd والمشفر النزیم GtfD مما یفسر قدرتها على تكوین ISSN: GIF: االغشیة الحیویة المسببة لتسوس االسنان. Introduction: Streptococcus mutans, a primary etiologic agent of human dental caries, is particularly effective at forming biofilms on the hard tissues of the human oral cavity. Adherence of S. mutans to dental surfaces is the first step in the formation of biofilms by this organism and is mediated by sucrosedependent and sucrose-independent mechanisms [1-]. S. mutans expresses several surface adhesins that can bind to salivary pellicles formed on the teeth [3], whereas sucrose-dependent adherence is mediated by glucan binding proteins and water-insoluble glucans produced from sucrose by glucosyl - transferase(gtf) enzymes []. Biofilms are sessile bacterial communities adherent to a surface, and their formation occurs in response to a variety of environmental cues [4-5]. Biofilm bacteria undergo a developmental program in response to environmental signals that leads to the expression of new phenotypes that distinguish * adhra_sal@yahoo.com 104

2 these sessile cells from planktonic cells (4-6). Of importance with respect to medicine, biofilm cells have been shown to be up to 1,000-fold more tolerant of antibiotics than are planktonic cells and genes [7] and protein expression profiles are altered in planktonic cells relative to those in biofilm-grown cells [6-4]. The ability of Streptococcus mutans to synthesize extracellular glucans is a critical virulence factor involved in the pathogenesis of dental caries in animals and humans [8, 9]. This bacterium harbors three distinct gtf genes expressing glucosyltransferase (GTF) activity [10]. The gtfb and gtfc genes are in an operon-like arrangement and encode enzymes that produce mostly water-insoluble α-(1-3)-linked glucans, whereas the gtfd gene, which is not linked to the gtfbc locus, encodes an enzyme that synthesizes water-soluble α-(1-6)-linked glucans. Glucans provide binding sites for, and promote accumulation of, cariogenic streptococci (and other oral microorganisms) on the tooth surface, and they contribute to the establishment of the extracellular polysaccharide matrix, which provides bulk and structural integrity to dental biofilms (known as dental plaque). The goal of this study is to detect gtf gent at different regiones (gtfb,gtfc,gtfd) in S. mutans isolates from dental plaque and caries that had efficient biofilm formation. Materials and methods: 1) Sample collection and Identification Sixty plaque and saliva samples were collected from individuals aged from 4 to 65 years old. Twenty two mutans streptococci local isolates were isolated from human dental plaque and dental caries by growing on : Mitis Salivarius Agar with 00 I.U/L bacitracin (MSB)and trypticase, yeast, cystine, sucrose, bacitracin agar (TYCSB) and identified according to biochemical test by growing blood agar medium and incubated anaerobically at 37 o C for 48 hrs and tested for their ability to ferment sucrose, mannitol, sorbitol and raffinose ) Sucrose-induced biofilm formation Crystal violet staining was used to measure biofilm formation as reported by Motegi et al. [11]. One hundred and sixty microliters of TSB (Tryptic soya broth with 1% sucrose ) with 40 ml of an overnight culture of bacteria were incubated in selected wells of sterile 96-well microtiter plates, control wells contain TSB without the addition of bacterial suspention.after incubation for 4 h, the planktonic bacteria were removed and the wells were washed with 0.9% saline, then the biofilm was fixed with % sodium acetate, washed again and 0.1% crystal violet was added to stain the biofilm for 15 min. The wells were rinsed again with 0.9% saline and 00 ml of ethanol was added to the wells to solubilize the dye, at last the ethanol was transferred to a new plate and the absorbance at 490 nm was recorded. Polymerase chain reaction Polymerase chain reaction (PCR) was used to confirm the presence or absence of the gtf BCD genes in the isolates. One colony of each bacterium from an agar plate was used as the template. The DNA was extracted by using ExiPrep TM Plus Bacteria Genomic DNA Kit (BIONEER, Korea) according to protocol for DNA extraction using ExiPrep TM 16 Plus machine. All primers used in detection gtf genes were designed according to Bioedit program and NCBI BLAST Website with conserved region listed in Table-1. PCR was performed with µl (100 ng) of template DNA in a total reaction volume of 0 µl consisting of 10 µl of GoTaq Green Master Mix (promega), µl of Forword Primer (10 µm), µl Primer (10 µm), 4 µl Nuclease free water. The PCR program consisted of 30 cycles of denaturation (94 C for 1 min), annealing (55 C for 1 min), and extension (7 C for 1 min) to amplified gtfb, while 30 cycles of denaturation (94 C for 1 min), annealing (6 C for 1 min), and extension (7 C for 1 min) and a final extension step at 7 C for 3 min to amplified gtfc and gtfd. A Master thermocycler gradient (Eppendorf, Germany) was used for PCR. The positive result of gtf genes was confirmed by % agarose gel electrophoresis stained with ethidium bromide, electrophoresed in 75 volt for 1 hr, and photographed under ultraviolet (UV) transilluminator. 105

3 Absorbance (490nm) Flayyih et al. Iraqi Journal of Science, 016, Vol. 57, No.1A, pp: Table 1- Primers of gtf genes used in qrt-pcr Primers Name gtf B Primer sequence (5 3 ) Forward TGGAAAAACTTCCCAATGTAAAA ACGAACTTTGCCGTTATTGTC Conserved region ( ) Origin gtf C Forward AGCAGATTCAACTGACGACC TCTTTTGCTGCTTCACTTGTCG (1-33) Promega /USA gtf D Forward GTTGACTTAGCGGCCATTCC TGAAGCTGTCCACGTTTTGC (48-908) Results and Discussion Biofilm formation by S. mutans isolates Twenty two isolates 36% were identified depending on the morphological and biochemical properties, and then confirmed by vitek compact systems.microtiter plates were used detecting the ability of S. mutans isolates to forming biofilm indicated that each isolate showed a different potential capacity to form biofilm,16 (7%) isolates were considered as a high or strong biofilm producers since their optical density were higher than 0.5 nm with the absorbance values ranged between 0.51nm-.5nm. Six (7%) isolates were considered as a mild or good biofilm producer since their optical density was higher than 0.1 nm Figure-1. The obtained results were higher than results of another local study by Al-kazirragy [1] found out 53% of the tested isolates were high producers while (46%) of isolates were good or mild producers. Biofilm Assay S. mutans isolates Sm1 Sm Sm3 Sm4 Sm5 Sm6 Sm7 Sm8 Sm9 Sm10 Figure 1- Biofilm formation for S. mutans isolates. Amplification of gtf genes from S. mutans isolates Glucosyltransferases (GTFs) are the primary virulence factors of S. mutans responsible for formation of dental biofilms and development of dental caries, therefore 3 genes gtfb, gtfc, and gtfd encoded GTFs were detected using monoplex PCR technique. 106

4 The DNA of 100% isolates of S. mutans were amplified for the detection gtf genes using monoplex pattern. Figure- showed that all S. mutans isolates have gtfb gene with 80bp that encoded a glucosyltransferase, GtfB, synthesized mostly insoluble glucans containing elevated amounts of α-1,3- linked glucose.after using designed primer for conserved region in gtfc gene, the result showed that all S. mutans isolates had gtfc gene appeared with band of 81bp, Figure-3 which encoded a glucosyltransferase GtfC that synthesized a mixture of insoluble and soluble glucans. In addition, Figure-4 depicts that all S. mutans isolates had bands with 34 bp that represented gtfd gene which encoded a glucosyltransferase GtfD that synthesized predominantly soluble glucans. The results showed that all 100% of S. mutans isolates had 3 gtf with different capacity to form biofilm due to the source of isolation (dental plaque, dental caries) also Shemesh et al [13] mentioned that accumulation of bacteria to the different types of dental surfaces such as implant, restorative material, or enamel, can be associated with the formation of different type of a biofilm due to different patterns of gene expression, especially those genes associated with biofilm regulation, formation and bacterial physiology. Figure - Amlification of a 80-bp gtb gene of S.mutans isolates on agarose gel (%) electrophoresed in 75 volt for 1 hr, M: molecular marker (5bp DNA Ladder), lanes 1 - refer to (Sm1-m1) Figure 3- Amlification of a 81-bp gtc1 gene of S.mutans isolates on agarose gel (%) electrophoresed in 75 volt for 1 hr, M: molecular marker (5bp DNA Ladder), lanes 1 - refer to (Sm1-m1). 107

5 Figure 4- Amlification of a 34-bp gtd1 gene of S.mutans isolates on agarose gel (%) electrophoresed in 75 volt for 1 hr, M: molecular marker (100 bp DNA Ladder), lanes 1 - refer to (Sm1-m1). References 1. Cvitkovitch, D. G., Y. H. Li, and R. P. Ellen Quorum sensing and biofilm formation in streptococcal infections. J. Clin. Investig. 11: Xiao, J. and H. Koo Structural organization and dynamics of exopolysaccharide matrix and microcolonies formation by Streptococcus mutans in biofilms. J. Appl Microbiol,108: Mitchell, T. J The pathogenesis of streptococcal infections: from tooth decay to meningitis. Nat. Rev. Microbiol. 1: O Toole, G. A., K. A. Gibbs, P. W. Hager, P. V. Phibbs, Jr., and R. Kolter The global carbon metabolism regulator Crc is a component of a signal transduction pathway required for biofilm development by Pseudomonas aeruginosa. J. Bacteriol. 18: O Toole, G. A., and R. Kolter Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30: Ericson, T., and J. Rundegren Characterization of a salivary agglutinin reacting with a serotype c strain of Streptococcus mutans. Eur. J. Biochem. 133: Hoyle, B. D., and J. W. Costerton Bacterial resistance to antibiotics: the role of biofilms. Prog. Drug Res. 37: Tanzer, J. M., M. L. Freedman, and R. J. Fitzgerald Virulence of mutants defective in glucosyltransferase, dextran-mediated aggregation, or dextranase activity, pp: In S. E. Mergenhagen and B. Rosan (ed.), Molecular basis of oral microbial adhesion. American Society for Microbiology, Washington, D.C. 9. Yamashita, Y., W. H. Bowen, R. A. Burne, and H. K. Kuramitsu Role of the Streptococcus mutans gtf genes in caries induction in the specificpathogen- free rat model. Infect. Immun. 61: Smith, E.G. and G.A. Spatafora. 01. Gene regulation in S. mutans: complex control in a complex environment. J. Dent Res, 91: Motegi, M; Y. Takagi; H. Yonezawa; N. Hanada; J. Terajima; H.Watanabe and H. Senpuku. (006). Assessment of genes associated with Streptococcus mutans biofilm morphology. App.l Environ. Microbiol., 7: Al-kazirragy S The effect of glucan binding protein on Streptococcus mutans biofilm formation and determination of chemical inhibitors. Thesis, College of Science, University of Baghdad, Baghdad, Iraq. 13. Shemesh, M., A. Tam, R. Aharoni and D. Steinberg Genetic adaptation of Streptococcus mutans during biofilm formation on different types of surfaces. BMC Microbiology, 10: